Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of RutR regulog to Escherichia coli O157:H7 str. EC4045

Reference regulog properties
Source regulog: RutR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4045
Orthologous TF(s) EschericoliO157_010100005070
Regulated genes 2
Built upon 13 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4045
Locus tag Position Score Sequence
Position: -183
Score: 6.2
Sequence: TTTTGACCGTTTAGTCCACT
Locus tag: EschericoliO157_010100005065
EschericoliO157_010100005065 -183 6.2 TTTTGACCGTTTAGTCCACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: rutA
Ortholog function: Pyrimidine oxygenase
Escherichia coli str. K-12 substr. MG1655 b1012 -126 6.2 TTTTGACCGTTTAGTCCACT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_01038 -181 6 TTTTGACCATCCAGTCCACT
Enterobacter sp. 638 Ent638_1525 -185 6.1 TTTTGACCATTCAGTCCACT
Serratia proteamaculans 568 Spro_1823 -187 5.8 TTTTGACCAAATGGTCTGTT
Position: -124
Score: 4.3
Sequence: AGTGGACTAAACGGTCAAAA
Locus tag: EschericoliO157_010100005070
EschericoliO157_010100005070 -124 4.3 AGTGGACTAAACGGTCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: rutR
Ortholog function: Transcriptional regulator RutR of pyrimidine catabolism, TetR family
Escherichia coli str. K-12 substr. MG1655 b1013 -124 4.3 AGTGGACTAAACGGTCAAAA