Propagation of SdaR regulog to Escherichia coli O157:H7 str. EC4206
| Source regulog: | SdaR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | SdaR |
| Regulation mode: | activator |
| Biological process: | Glucarate utilization; Galactarate utilization |
| Effector: | Glycerate |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Escherichia coli O157:H7 str. EC4206 |
| Orthologous TF(s) | EschericcoliO157_010100005078 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -69
Score: 5.3 Sequence: CTTTAGGCATTTGCACAATG
Locus tag: EschericcoliO157_010100005078
|
||||
| EschericcoliO157_010100005078 | -69 | 5.3 | CTTTAGGCATTTGCACAATG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: sdaR | ||||
| Ortholog function: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family | ||||
| Escherichia coli str. K-12 substr. MG1655 | b0162 | -69 | 5.3 | CTTTAGGCATTTGCACAATG |
| Salmonella typhimurium LT2 | STM0210 | -71 | 5.8 | TTTTGTGCATTTGCACAATG |
| Citrobacter koseri ATCC BAA-895 | CKO_03205 | -17 | 5.1 | GTTTGTGCAGATGCACAATG |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00177 | -17 | 5.4 | CTTAGTGCAAATGCACAATG |
| Enterobacter sp. 638 | Ent638_0702 | -71 | 5.3 | CTTTGTGCATTCGCACAATG |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3300 | -80 | 4.3 | CTTTGTTAATTTGCACAATG |