Propagation of Zur regulog to Escherichia coli UTI89
| Source regulog: | Zur - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Escherichia coli UTI89 |
| Orthologous TF(s) | UTI89_C4616 |
| Regulated genes | 4 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -53
Score: 6.3 Sequence: GGATTGTTATATTATAACAGTTC
Locus tag: UTI89_C1364
|
||||
| UTI89_C1364 | -53 | 6.3 | GGATTGTTATATTATAACAGTTC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: pliG | ||||
| Ortholog function: periplasmic lysozme inhibitor of g-type lysozyme | ||||
| Escherichia coli str. K-12 substr. MG1655 | b1178 | -53 | 6.3 | GGATTGTTATATTATAACAGTTC |
| Salmonella typhimurium LT2 | STM2610 | -54 | 5.9 | TTATTGTTACAATATAACAATTA |
|
Position: -49
Score: 6.3 Sequence: GAACTGTGATATTATAACATTTC
Locus tag: UTI89_C2062
|
||||
| UTI89_C2062 | -49 | 6.3 | GAACTGTGATATTATAACATTTC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: znuC | ||||
| Ortholog function: high-affinity zinc ABC transporter, ATP-binding protein | ||||
| Escherichia coli str. K-12 substr. MG1655 | b1858 | -49 | 6.5 | GAAGTGTGATATTATAACATTTC |
| Salmonella typhimurium LT2 | STM1892.S | -49 | 6.7 | GAAATGTGATATTATAACATTCT |
| Citrobacter koseri ATCC BAA-895 | CKO_01105 | -49 | 6.7 | GAAATGTGATATTATAACATTCT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_02373 | -49 | 6.4 | GTGATGTGATATTATAACATTCA |
| Enterobacter sp. 638 | Ent638_2427 | -48 | 6.2 | TGGATGTGATATTATAACATTCG |
| Erwinia amylovora ATCC 49946 | EAM_2001 | -48 | 6.1 | ATTTTGTGATATTATAACATTTG |
| Yersinia pestis KIM | y2250 | -47 | 5.7 | AAAGCGTAATATTATAACATTCA |
| Serratia proteamaculans 568 | Spro_2774 | -50 | 5.8 | GAGGCGTGATATTATAACATTCG |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA2485 | -46 | 6.4 | TGTTTGTTATATTATAACATTAC |
| Edwardsiella tarda EIB202 | ETAE_1442 | -72 | 6.7 | GAAACGTTATATTATAACATTCC |
| Proteus mirabilis HI4320 | PMI1151 | -47 | 6.7 | GAAATGTTATATTATAACGTTTC |
| Photorhabdus luminescens subsp. laumondii TTO1 | plu2114 | -48 | 6.6 | GAATTGTTATATTATAACATCTC |
|
Position: -56
Score: 6.2 Sequence: CATATGTTACAATATAACATTAC
Locus tag: UTI89_C2172
|
||||
| UTI89_C2172 | -56 | 6.2 | CATATGTTACAATATAACATTAC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: zinT | ||||
| Ortholog function: zinc-binding protein | ||||
| Escherichia coli str. K-12 substr. MG1655 | b1973 | -56 | 6.3 | TATATGTTACAATATAACATTAC |
| Salmonella typhimurium LT2 | STM1263 | -54 | 6.2 | GCAATGTTATAATATAACAATCA |
| Citrobacter koseri ATCC BAA-895 | CKO_01827 | -91 | 6.8 | GTGATGTTATATTATAACATTCC |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04244 | -55 | 5.7 | GATATGTTATATCGTAACAATTT |
| Enterobacter sp. 638 | Ent638_1993 | -53 | 6.1 | GATATGTTATACTATAACATCCT |
| Proteus mirabilis HI4320 | PMI3380 | -38 | 6.5 | ATATTGTTATATTATAACATTAC |