Propagation of AscG regulog to Shigella boydii BS512

Reference regulog properties
Source regulog:	AscG - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization; Cellobiose utilization
Effector:	Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Shigella boydii BS512
Orthologous TF(s)	SbBS512_E3162
Regulated genes	1

Built upon 28 sites [see more]

Predicted regulatory interactions in *Shigella boydii BS512*
	Locus tag	Position	Score	Sequence
Position: -175 Score: 6.6 Sequence: TTAGGAAACCGGTTTCACAA Locus tag: SbBS512_E3162
	SbBS512_E3162	-175	6.6	TTAGGAAACCGGTTTCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ascG
Ortholog function: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
Escherichia coli str. K-12 substr. MG1655	b2714	-175	6.3	TTAAGAAACCGGTTTCACAA
Citrobacter koseri ATCC BAA-895	CKO_04069	-172	6.7	ATAGGAAACCGGTTCCACAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_03050	-194	6.7	ATAGGAAACCGGTTCCACAA
Enterobacter sp. 638	Ent638_3187	-182	6.7	ATAGGAAACCGGTTTCACAA
Serratia proteamaculans 568	Spro_0577	-193	6.5	ATAAGAAACCGGTTTCACAA
Erwinia carotovora subsp. atroseptica SCRI1043	ECA2164	-173	6	ATGGGTAACCGGTTCCACAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --