Propagation of Zur regulog to Yersinia pestis FV-1
| Source regulog: | Zur - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Yersinia pestis FV-1 |
| Orthologous TF(s) | YpesF_010100004430 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: 6
Score: 5.1 Sequence: TATGTGTTACATTATAACGGTTT
Locus tag: YpesF_010100019486
|
||||
| YpesF_010100019486 | 6 | 5.1 | TATGTGTTACATTATAACGGTTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ECA3248 | ||||
| Ortholog function: ABC-type uncharacterized transport system, periplasmic component | ||||
| Yersinia pestis KIM | y1329 | 6 | 5.1 | TATGTGTTACATTATAACGGTTT |
| Serratia proteamaculans 568 | Spro_3632 | -3 | 5.3 | TTTATGTTACTTTATAACAATAA |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3248 | -3 | 5.7 | ATAATGTTACATTATAACGCTTT |
| Proteus mirabilis HI4320 | PMI1519 | -42 | 6.1 | GTGATGTTATATTATAACAAAAT |