Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Yersinia pestis FV-1

Reference regulog properties
Source regulog: Zur - Enterobacteriales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Yersinia pestis FV-1
Orthologous TF(s) YpesF_010100004430
Regulated genes 1
Built upon 65 sites [see more]
Predicted regulatory interactions in Yersinia pestis FV-1
Locus tag Position Score Sequence
Position: 6
Score: 5.1
Sequence: TATGTGTTACATTATAACGGTTT
Locus tag: YpesF_010100019486
YpesF_010100019486 6 5.1 TATGTGTTACATTATAACGGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ECA3248
Ortholog function: ABC-type uncharacterized transport system, periplasmic component
Yersinia pestis KIM y1329 6 5.1 TATGTGTTACATTATAACGGTTT
Serratia proteamaculans 568 Spro_3632 -3 5.3 TTTATGTTACTTTATAACAATAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3248 -3 5.7 ATAATGTTACATTATAACGCTTT
Proteus mirabilis HI4320 PMI1519 -42 6.1 GTGATGTTATATTATAACAAAAT
© 2009-2020 RegPrecise