Propagation of SdaR regulog to Salmonella enterica subsp. enterica serovar Heidelberg str. SL476
Source regulog: | SdaR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | SdaR |
Regulation mode: | activator |
Biological process: | Glucarate utilization; Galactarate utilization |
Effector: | Glycerate |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 |
Orthologous TF(s) | SeHA_C0247 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -71
Score: 5.8 Sequence: TTTTGTGCATTTGCACAATG
Locus tag: SeHA_C0247
|
||||
SeHA_C0247 | -71 | 5.8 | TTTTGTGCATTTGCACAATG | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: sdaR | ||||
Ortholog function: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family | ||||
Escherichia coli str. K-12 substr. MG1655 | b0162 | -69 | 5.3 | CTTTAGGCATTTGCACAATG |
Salmonella typhimurium LT2 | STM0210 | -71 | 5.8 | TTTTGTGCATTTGCACAATG |
Citrobacter koseri ATCC BAA-895 | CKO_03205 | -17 | 5.1 | GTTTGTGCAGATGCACAATG |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00177 | -17 | 5.4 | CTTAGTGCAAATGCACAATG |
Enterobacter sp. 638 | Ent638_0702 | -71 | 5.3 | CTTTGTGCATTCGCACAATG |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3300 | -80 | 4.3 | CTTTGTTAATTTGCACAATG |