Propagation of CymR regulog to Paenibacillus larvae subsp. larvae BRL-230010

Reference regulog properties
Source regulog:	CymR - Bacillales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Phylum:	Firmicutes
Propagated regulon:
Target genome	Paenibacillus larvae subsp. larvae BRL-230010
Orthologous TF(s)	Plarl_010100022318, Plarl_010100015839
Regulated genes	1

Built upon 65 sites [see more]

Predicted regulatory interactions in *Paenibacillus larvae subsp. larvae BRL-230010*
	Locus tag	Position	Score	Sequence
Position: -110 Score: 4.8 Sequence: CAAAACATAGTAATTATATAGTAATAA Locus tag: Plarl_010100021993
	Plarl_010100021993	-110	4.8	CAAAACATAGTAATTATATAGTAATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: subI
Ortholog function: Sulfate ABC transporter (sulfate-binding protein)
Bacillus cereus ATCC 14579	BC1090	-158	5.4	AAATTCCAAGTTGACACATATGAATTA
Bacillus cereus ATCC 14579	BC1091	-158	5.4	AAATTCCAAGTTGACACATATGAATTA
Bacillus halodurans C-125	BH3127	-142	4.8	TAAAACCCACTTGACAGATGGGGATTA
		-50	4.6	TAAAACAGACTTTTCCGATCTGTTTTA
Paenibacillus sp. JDR-2	Pjdr2_4823	-96	4.7	CATAACCAACTAAACAGGTAGGAATAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --