Propagation of IclR regulog to Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433
Source regulog: | IclR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | IclR |
Regulation mode: | repressor |
Biological process: | Glyoxylate bypass |
Effector: | Pyruvate; Glyoxylate |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433 |
Orthologous TF(s) | Sententeric_010100011277 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -125
Score: 8.3 Sequence: AAAATGGAAATTGTTTTTGATTTT
Locus tag: Sententeric_010100011252
|
||||
Sententeric_010100011252 | -125 | 8.3 | AAAATGGAAATTGTTTTTGATTTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: aceB | ||||
Ortholog function: malate synthase A | ||||
Escherichia coli str. K-12 substr. MG1655 | b4014 | -125 | 8.3 | AAAATGGAAATTGTTTTTGATTTT |
Salmonella typhimurium LT2 | STM4183 | -125 | 8.3 | AAAATGGAAATTGTTTTTGATTTT |
Citrobacter koseri ATCC BAA-895 | CKO_03906 | -125 | 8.3 | AAAATGGAAATTGTTTTTGATTTT |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04395 | -117 | 8.3 | AAAATGGAAATTGTTTTTGATTTT |
Enterobacter sp. 638 | Ent638_0218 | -127 | 8.3 | AAAATGGAAATTGTTTTTGATTTT |
Yersinia pestis KIM | y0015 | -147 | 8.2 | AAAATGGAAATCGTTTTTGATTTT |
Serratia proteamaculans 568 | Spro_4503 | -172 | 8.1 | AAAATGGAAATGGTTTTTGATTTT |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA3991 | -132 | 8.3 | AAAATGGAAATTGTTTTTGATTTT |
Proteus mirabilis HI4320 | PMI2764 | -80 | 7.6 | AAAATGGAATTCATTTTTGATTTT |
Photorhabdus luminescens subsp. laumondii TTO1 | plu4396 | -77 | 7.9 | AAAATGGAAATCGTTTTTGATTTA |