Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MarR regulog to Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433

Reference regulog properties
Source regulog: MarR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: MarR
Regulation mode: repressor
Biological process: Antibiotic resistance
Effector: Salicylate; Tetracycline; Chloramphenicol
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433
Orthologous TF(s) Sententeric_010100000810
Regulated genes 1
Built upon 10 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433
Locus tag Position Score Sequence
Position: -22
Score: 6.8
Sequence: ATTACTTGCCGGGGCAACCATT
Locus tag: Sententeric_010100000810
Sententeric_010100000810 -22 6.8 ATTACTTGCCGGGGCAACCATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: marR
Ortholog function: DNA-binding transcriptional repressor MarR
Escherichia coli str. K-12 substr. MG1655 b1530 -57 6.8 TATACTTGCCTGGGCAATATTA
-22 6.3 ATTACTTGCCAGGGCAACTAAT
Salmonella typhimurium LT2 STM1520 -57 7 TATACTTGCCTGGGCAATAGTA
-22 6.8 ATTACTTGCCGGGGCAACCATT