Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NagC regulog to Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433

Reference regulog properties
Source regulog: NagC - Enterobacteriales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor (activator)
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433
Orthologous TF(s) Sententeric_010100024703
Regulated genes 4
Built upon 68 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433
Locus tag Position Score Sequence
Position: -140
Score: 4.7
Sequence: TATTTTTCAGATAATTAAATAAT
Locus tag: Sententeric_010100008428
Sententeric_010100008428 -140 4.7 TATTTTTCAGATAATTAAATAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: galP
Ortholog function: D-galactose transporter
Escherichia coli str. K-12 substr. MG1655 b2943 -39 5.2 CTTAATTCACAATAAAAAATAAC
Salmonella typhimurium LT2 STM3091 -139 4.7 TATTTTTCAGATAATTAAATAAT
Position: -232
Score: 5.1
Sequence: CTTATTTATTATCGCGAATTATT
Locus tag: Sententeric_010100020652
Sententeric_010100020652 -232 5.1 CTTATTTATTATCGCGAATTATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: chbB
Ortholog function: PTS system, chitobiose-specific IIB component (EC 2.7.1.69)
Salmonella typhimurium LT2 STM1312 -232 5.1 CTTATTTATTATCGCGAATTATT
Position: -141
Score: 5.2
Sequence: TTTTTTTCGATATCTAAAATAAT
Locus tag: Sententeric_010100024588
Sententeric_010100024588 -141 5.2 TTTTTTTCGATATCTAAAATAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: manX
Ortholog function: PTS system, mannose-specific IIAB component
Salmonella typhimurium LT2 STM1830 -141 5.2 TTTTTTTCGATATCTAAAATAAT
Citrobacter koseri ATCC BAA-895 CKO_01161 -139 5.4 TTTTTTTCGCTATCTAAAATAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02333 -203 5 TATTTTTTGCGCTGCAAAATTAT
-138 5.2 ATTTTTTCACTGTCTAAAATAAT
Enterobacter sp. 638 Ent638_2386 -141 5.2 ATTTTTTCACTGTCTAAAATAAT
Position: -147
Score: 5.8
Sequence: TTTAATTTGCGAGGCGAATTAAT
Locus tag: Sententeric_010100024683
Sententeric_010100024683 -147 5.8 TTTAATTTGCGAGGCGAATTAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nagE
Ortholog function: PTS system, N-acetylglucosamine-specific IIABC component
Escherichia coli str. K-12 substr. MG1655 b0679 -146 5.9 TTTAATTTGCGATACGAATTAAA
Salmonella typhimurium LT2 STM0685 -241 4.8 GATTTTTTGAATCATAAAATAAG
-147 5.8 TTTAATTTGCGAGGCGAATTAAT
Citrobacter koseri ATCC BAA-895 CKO_02485 -151 6 TTTAATTTGCGATACGAATTAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00700 -123 6 TTTAATTTGCGATACGAATTAAT
Erwinia amylovora ATCC 49946 EAM_1148 -226 4.8 GATTTTTTGAATCATAAAATAAG
-132 5.4 ATTAATTTGCTGTACGAATTTAT
Serratia proteamaculans 568 Spro_1228 -132 6 TTTAATTTGCGATACGAAATAAT
Photorhabdus luminescens subsp. laumondii TTO1 plu1318 -88 5.3 ATTATTTTTCAACTAAAAATAAG