Propagation of HrcA regulog to Paenibacillus larvae subsp. larvae BRL-230010

Reference regulog properties
Source regulog:	HrcA - Bacillales
Regulator type:	Transcription factor
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Phylum:	Firmicutes
Propagated regulon:
Target genome	Paenibacillus larvae subsp. larvae BRL-230010
Orthologous TF(s)	Plarl_010100025538, Plarl_010100022895
Regulated genes	1

Built upon 26 sites [see more]

Predicted regulatory interactions in *Paenibacillus larvae subsp. larvae BRL-230010*
	Locus tag	Position	Score	Sequence
Position: -123 Score: 7.1 Sequence: TTAGCACTCTAAAGATTGGAGTGCTAA Locus tag: Plarl_010100001348
	Plarl_010100001348	-123	7.1	TTAGCACTCTAAAGATTGGAGTGCTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: htpG
Ortholog function: Heat shock chaperone protein 90
Bacillus halodurans C-125	BH1007	-126	7.1	TTAGCACTCGTTGCTTGCAAGTGCTAA
Bacillus clausii KSM-K16	ABC0970	-63	7.5	TTAGCACTCTAAACAAACGAGTGCTAA
Oceanobacillus iheyensis HTE831	OB3158	-52	7.6	TTAGCACTCGTAAGTAGTGAGTGCTAA
Paenibacillus sp. JDR-2	Pjdr2_5425	-64	7	TTAGCACTCCAACACGGAGAGTGCTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --