Propagation of PsrA regulog to Ralstonia pickettii 12J
Source regulog: | PsrA - Ralstonia |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Fatty acid degradation |
Effector: | Oleate |
Phylum: | Proteobacteria/beta |
Propagated regulon: | |
Target genome | Ralstonia pickettii 12J |
Orthologous TF(s) | Rpic_0418 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -121
Score: 4.5 Sequence: TTTCAAACGTCTGTTCCTAA
Locus tag: Rpic_0418
|
||||
Rpic_0418 | -121 | 4.5 | TTTCAAACGTCTGTTCCTAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: psrA | ||||
Ortholog function: Transcriptional regulator for fatty acid degradation PsrA, TetR family | ||||
Ralstonia solanacearum GMI1000 | RS04928 | -122 | 4.6 | TTTAAAACATCCGTTCCTAA |
Ralstonia pickettii 12J | Rpic_0418 | -121 | 4.5 | TTTCAAACGTCTGTTCCTAA |
Ralstonia eutropha JMP134 | Reut_A3446 | -120 | 3.6 | ATTAGAGCAGGCATTCGAAT |
Ralstonia eutropha H16 | H16_A3736 | -104 | 4 | CTTCGTACAGCTGTTTCAAG |
Cupriavidus taiwanensis | RALTA_A3194 | -105 | 4 | CTTCGTACAGCTGTTTCAAG |
Position: -122
Score: 4.1 Sequence: ATTTAAATGGCTTTTAGCAT
Locus tag: Rpic_0918
|
||||
Rpic_0918 | -122 | 4.1 | ATTTAAATGGCTTTTAGCAT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: acpP | ||||
Ortholog function: Acyl carrier protein | ||||
Ralstonia metallidurans CH34 | Rmet_2427 | -226 | 2.5 | CATCAAACGCGGGTATGATG |
Ralstonia eutropha JMP134 | Reut_A2262 | -198 | 2.5 | GATCAAACGCGGGTATGATG |
Ralstonia eutropha H16 | H16_A2566 | -200 | 2.5 | CATCAAACGCGGGTATGATG |
Cupriavidus taiwanensis | RALTA_A2069 | -201 | 2.5 | CATCAAACGCGGGTATGATG |