Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PsrA regulog to Ralstonia solanacearum GMI1000

Reference regulog properties
Source regulog: PsrA - Ralstonia
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Propagated regulon:
Target genome Ralstonia solanacearum GMI1000
Orthologous TF(s) RS04928
Regulated genes 1
Built upon 9 sites [see more]
Predicted regulatory interactions in Ralstonia solanacearum GMI1000
Locus tag Position Score Sequence
Position: -122
Score: 4.6
Sequence: TTTAAAACATCCGTTCCTAA
Locus tag: RS04928
RS04928 -122 4.6 TTTAAAACATCCGTTCCTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: psrA
Ortholog function: Transcriptional regulator for fatty acid degradation PsrA, TetR family
Ralstonia solanacearum GMI1000 RS04928 -122 4.6 TTTAAAACATCCGTTCCTAA
Ralstonia pickettii 12J Rpic_0418 -121 4.5 TTTCAAACGTCTGTTCCTAA
Ralstonia eutropha JMP134 Reut_A3446 -120 3.6 ATTAGAGCAGGCATTCGAAT
Ralstonia eutropha H16 H16_A3736 -104 4 CTTCGTACAGCTGTTTCAAG
Cupriavidus taiwanensis RALTA_A3194 -105 4 CTTCGTACAGCTGTTTCAAG
© 2009-2020 RegPrecise