Propagation of PhnF regulog to Burkholderia thailandensis MSMB43

Reference regulog properties
Source regulog:	PhnF - Ralstonia
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Phylum:	Proteobacteria/beta
Propagated regulon:
Target genome	Burkholderia thailandensis MSMB43
Orthologous TF(s)	Bpse38_010100014977
Regulated genes	2

Built upon 8 sites [see more]

Predicted regulatory interactions in *Burkholderia thailandensis MSMB43*
	Locus tag	Position	Score	Sequence
Position: -66 Score: 6.9 Sequence: TATAGACGTCTAGACGTTTAGA Locus tag: Bpse38_010100014972
	Bpse38_010100014972	-66	6.9	TATAGACGTCTAGACGTTTAGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnG
Ortholog function: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
Ralstonia metallidurans CH34	Rmet_0766	-29	7	TCTAAACGTATAGACGTATAGG
Ralstonia eutropha JMP134	Reut_B4186	-29	6.7	TCTACACGTATAGACGTATAGG
Ralstonia eutropha H16	H16_B1288	-26	7	TCTAAACGTATAGACGTATAGG
Cupriavidus taiwanensis	RALTA_B1191	-23	7	TCTAAACGTATAGACGTATAGG

Position: -129 Score: 6.9 Sequence: TCTAAACGTCTAGACGTCTATA Locus tag: Bpse38_010100014977
	Bpse38_010100014977	-129	6.9	TCTAAACGTCTAGACGTCTATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnF
Ortholog function: Transcriptional regulator for phosphonate utilization, GntR family
Ralstonia metallidurans CH34	Rmet_0767	-155	7	CCTATACGTCTATACGTTTAGA
Ralstonia eutropha JMP134	Reut_B4185	-243	6.7	CCTATACGTCTATACGTGTAGA
Ralstonia eutropha H16	H16_B1289	-174	7	CCTATACGTCTATACGTTTAGA
Cupriavidus taiwanensis	RALTA_B1192	-174	7	CCTATACGTCTATACGTTTAGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --