Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of LexA regulog to Polynucleobacter necessarius STIR1

Reference regulog properties
Source regulog: LexA - Ralstonia
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/beta
Propagated regulon:
Target genome Polynucleobacter necessarius STIR1
Orthologous TF(s) Pnec_0426
Regulated genes 1
Built upon 62 sites [see more]
Predicted regulatory interactions in Polynucleobacter necessarius STIR1
Locus tag Position Score Sequence
Position: -91
Score: 6.1
Sequence: TACTGTTTTTATATACAGTA
Locus tag: Pnec_1549
Pnec_1549 -91 6.1 TACTGTTTTTATATACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: recA
Ortholog function: Recombinase A
Ralstonia solanacearum GMI1000 RSc0551 -180 5.5 CACTGGTTTTTTATACAGTA
Ralstonia pickettii 12J Rpic_0471 -172 5.5 CACTGGTTTTTTATACAGTA
Ralstonia metallidurans CH34 Rmet_0466 -171 6.1 TACTGTTTTTTTATACAGTA
Ralstonia eutropha JMP134 Reut_A0527 -194 6.1 TACTGTTTTTTTATACAGTA
Ralstonia eutropha H16 H16_A0544 -159 6.1 TACTGTTTTTTTATACAGTA
Cupriavidus taiwanensis RALTA_A0499 -159 6.1 TACTGTTTTTTTATACAGTA