Propagation of PsrA regulog to Ralstonia pickettii 12D
| Source regulog: | PsrA - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/beta |
| Propagated regulon: | |
| Target genome | Ralstonia pickettii 12D |
| Orthologous TF(s) | Rpic12D_0433 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -121
Score: 4.5 Sequence: TTTCAAACGTCTGTTCCTAA
Locus tag: Rpic12D_0433
|
||||
| Rpic12D_0433 | -121 | 4.5 | TTTCAAACGTCTGTTCCTAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: psrA | ||||
| Ortholog function: Transcriptional regulator for fatty acid degradation PsrA, TetR family | ||||
| Ralstonia solanacearum GMI1000 | RS04928 | -122 | 4.6 | TTTAAAACATCCGTTCCTAA |
| Ralstonia pickettii 12J | Rpic_0418 | -121 | 4.5 | TTTCAAACGTCTGTTCCTAA |
| Ralstonia eutropha JMP134 | Reut_A3446 | -120 | 3.6 | ATTAGAGCAGGCATTCGAAT |
| Ralstonia eutropha H16 | H16_A3736 | -104 | 4 | CTTCGTACAGCTGTTTCAAG |
| Cupriavidus taiwanensis | RALTA_A3194 | -105 | 4 | CTTCGTACAGCTGTTTCAAG |
|
Position: -122
Score: 3.5 Sequence: ATTTAACTGGCTTTTAGCAT
Locus tag: Rpic12D_0983
|
||||
| Rpic12D_0983 | -122 | 3.5 | ATTTAACTGGCTTTTAGCAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: acpP | ||||
| Ortholog function: Acyl carrier protein | ||||
| Ralstonia metallidurans CH34 | Rmet_2427 | -226 | 2.5 | CATCAAACGCGGGTATGATG |
| Ralstonia eutropha JMP134 | Reut_A2262 | -198 | 2.5 | GATCAAACGCGGGTATGATG |
| Ralstonia eutropha H16 | H16_A2566 | -200 | 2.5 | CATCAAACGCGGGTATGATG |
| Cupriavidus taiwanensis | RALTA_A2069 | -201 | 2.5 | CATCAAACGCGGGTATGATG |