Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of LexA regulog to Burkholderia pseudomallei 305

Reference regulog properties
Source regulog: LexA - Ralstonia
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/beta
Propagated regulon:
Target genome Burkholderia pseudomallei 305
Orthologous TF(s) BURPS305_1334
Regulated genes 2
Built upon 62 sites [see more]
Predicted regulatory interactions in Burkholderia pseudomallei 305
Locus tag Position Score Sequence
Position: -67
Score: 6.4
Sequence: TACTGTATGTTTATACAGTA
Locus tag: BURPS305_7638
BURPS305_7638 -67 6.4 TACTGTATGTTTATACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF04055
Ortholog function: DNA repair photolyase
Ralstonia metallidurans CH34 Rmet_0742 -48 6.5 TACTGTATATTTATACAGTA
Ralstonia eutropha H16 H16_A0887 -44 6.5 TACTGTATATATATACAGTG
© 2009-2020 RegPrecise