Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PhnF regulog to Burkholderia mallei 2002721280

Reference regulog properties
Source regulog: PhnF - Ralstonia
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Phylum: Proteobacteria/beta
Propagated regulon:
Target genome Burkholderia mallei 2002721280
Orthologous TF(s) Bmal2_03004497
Regulated genes 2
Built upon 8 sites [see more]
Predicted regulatory interactions in Burkholderia mallei 2002721280
Locus tag Position Score Sequence
Position: -90
Score: 6.9
Sequence: TATAGACGTCTAGACGTTTAGA
Locus tag: Bmal2_03004496
Bmal2_03004496 -90 6.9 TATAGACGTCTAGACGTTTAGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnG
Ortholog function: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
Ralstonia metallidurans CH34 Rmet_0766 -29 7 TCTAAACGTATAGACGTATAGG
Ralstonia eutropha JMP134 Reut_B4186 -29 6.7 TCTACACGTATAGACGTATAGG
Ralstonia eutropha H16 H16_B1288 -26 7 TCTAAACGTATAGACGTATAGG
Cupriavidus taiwanensis RALTA_B1191 -23 7 TCTAAACGTATAGACGTATAGG
Position: -130
Score: 6.9
Sequence: TCTAAACGTCTAGACGTCTATA
Locus tag: Bmal2_03004497
Bmal2_03004497 -130 6.9 TCTAAACGTCTAGACGTCTATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnF
Ortholog function: Transcriptional regulator for phosphonate utilization, GntR family
Ralstonia metallidurans CH34 Rmet_0767 -155 7 CCTATACGTCTATACGTTTAGA
Ralstonia eutropha JMP134 Reut_B4185 -243 6.7 CCTATACGTCTATACGTGTAGA
Ralstonia eutropha H16 H16_B1289 -174 7 CCTATACGTCTATACGTTTAGA
Cupriavidus taiwanensis RALTA_B1192 -174 7 CCTATACGTCTATACGTTTAGA