Propagation of PhnF regulog to Burkholderia phytofirmans PsJN

Reference regulog properties
Source regulog:	PhnF - Ralstonia
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization
Effector:
Phylum:	Proteobacteria/beta
Propagated regulon:
Target genome	Burkholderia phytofirmans PsJN
Orthologous TF(s)	Bphyt_5939
Regulated genes	2

Built upon 8 sites [see more]

Predicted regulatory interactions in *Burkholderia phytofirmans PsJN*
	Locus tag	Position	Score	Sequence
Position: -135 Score: 7.3 Sequence: TCTAAACGTCTAGACGTTTAGG Locus tag: Bphyt_5939
	Bphyt_5939	-135	7.3	TCTAAACGTCTAGACGTTTAGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnF
Ortholog function: Transcriptional regulator for phosphonate utilization, GntR family
Ralstonia metallidurans CH34	Rmet_0767	-155	7	CCTATACGTCTATACGTTTAGA
Ralstonia eutropha JMP134	Reut_B4185	-243	6.7	CCTATACGTCTATACGTGTAGA
Ralstonia eutropha H16	H16_B1289	-174	7	CCTATACGTCTATACGTTTAGA
Cupriavidus taiwanensis	RALTA_B1192	-174	7	CCTATACGTCTATACGTTTAGA

Position: -129 Score: 7.3 Sequence: CCTAAACGTCTAGACGTTTAGA Locus tag: Bphyt_5940
	Bphyt_5940	-129	7.3	CCTAAACGTCTAGACGTTTAGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: phnG
Ortholog function: Methylphosphonate degradation complex, carbon-phosphorus lyase subunit PhnG
Ralstonia metallidurans CH34	Rmet_0766	-29	7	TCTAAACGTATAGACGTATAGG
Ralstonia eutropha JMP134	Reut_B4186	-29	6.7	TCTACACGTATAGACGTATAGG
Ralstonia eutropha H16	H16_B1288	-26	7	TCTAAACGTATAGACGTATAGG
Cupriavidus taiwanensis	RALTA_B1191	-23	7	TCTAAACGTATAGACGTATAGG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --