Propagation of LexA regulog to Polynucleobacter sp. QLW-P1DMWA-1

Reference regulog properties
Source regulog:	LexA - Ralstonia
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Proteobacteria/beta
Propagated regulon:
Target genome	Polynucleobacter sp. QLW-P1DMWA-1
Orthologous TF(s)	Pnuc_0418
Regulated genes	1

Built upon 62 sites [see more]

Predicted regulatory interactions in *Polynucleobacter sp. QLW-P1DMWA-1*
	Locus tag	Position	Score	Sequence
Position: -90 Score: 6.1 Sequence: TACTGTTTTTATATACAGTA Locus tag: Pnuc_1833
	Pnuc_1833	-90	6.1	TACTGTTTTTATATACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: recA
Ortholog function: Recombinase A
Ralstonia solanacearum GMI1000	RSc0551	-180	5.5	CACTGGTTTTTTATACAGTA
Ralstonia pickettii 12J	Rpic_0471	-172	5.5	CACTGGTTTTTTATACAGTA
Ralstonia metallidurans CH34	Rmet_0466	-171	6.1	TACTGTTTTTTTATACAGTA
Ralstonia eutropha JMP134	Reut_A0527	-194	6.1	TACTGTTTTTTTATACAGTA
Ralstonia eutropha H16	H16_A0544	-159	6.1	TACTGTTTTTTTATACAGTA
Cupriavidus taiwanensis	RALTA_A0499	-159	6.1	TACTGTTTTTTTATACAGTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --