Propagation of LexA regulog to Burkholderia multivorans CGD2M

Reference regulog properties
Source regulog:	LexA - Ralstonia
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Proteobacteria/beta
Propagated regulon:
Target genome	Burkholderia multivorans CGD2M
Orthologous TF(s)	BURMUCGD2M_2146
Regulated genes	3

Built upon 62 sites [see more]

Predicted regulatory interactions in *Burkholderia multivorans CGD2M*
	Locus tag	Position	Score	Sequence
Position: -130 Score: 6.1 Sequence: AACTGTATGAATATACAGTA Locus tag: BURMUCGD2M_6316
	BURMUCGD2M_6316	-130	6.1	AACTGTATGAATATACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: uvrA
Ortholog function: Excinuclease ABC subunit A
Ralstonia metallidurans CH34	Rmet_4549	-150	6.1	CACTGTATGTTCATACAGTA
Ralstonia eutropha JMP134	Reut_B4240	-160	5.6	CACTGTACGGATATACAGTC
Ralstonia eutropha H16	H16_B1571	-72	5.7	GACTGTATGGATGTACAGTG
Cupriavidus taiwanensis	RALTA_B1379	-71	5.7	GACTGTATGGATGTACAGTG

Position: -94 Score: 5.8 Sequence: CACTGTTTTTTTATACAGTG Locus tag: BURMUCGD2M_0893
	BURMUCGD2M_0893	-94	5.8	CACTGTTTTTTTATACAGTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: recA
Ortholog function: Recombinase A
Ralstonia solanacearum GMI1000	RSc0551	-180	5.5	CACTGGTTTTTTATACAGTA
Ralstonia pickettii 12J	Rpic_0471	-172	5.5	CACTGGTTTTTTATACAGTA
Ralstonia metallidurans CH34	Rmet_0466	-171	6.1	TACTGTTTTTTTATACAGTA
Ralstonia eutropha JMP134	Reut_A0527	-194	6.1	TACTGTTTTTTTATACAGTA
Ralstonia eutropha H16	H16_A0544	-159	6.1	TACTGTTTTTTTATACAGTA
Cupriavidus taiwanensis	RALTA_A0499	-159	6.1	TACTGTTTTTTTATACAGTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --