Propagation of PsrA regulog to Burkholderia cenocepacia HI2424
| Source regulog: | PsrA - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/beta |
| Propagated regulon: | |
| Target genome | Burkholderia cenocepacia HI2424 |
| Orthologous TF(s) | Bcen2424_1535 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -73
Score: 6.2 Sequence: ATAAAAACGACTGTTTGAAT
Locus tag: Bcen2424_1535
|
||||
| Bcen2424_1535 | -73 | 6.2 | ATAAAAACGACTGTTTGAAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: psrA | ||||
| Ortholog function: Transcriptional regulator for fatty acid degradation PsrA, TetR family | ||||
| Ralstonia solanacearum GMI1000 | RS04928 | -122 | 4.6 | TTTAAAACATCCGTTCCTAA |
| Ralstonia pickettii 12J | Rpic_0418 | -121 | 4.5 | TTTCAAACGTCTGTTCCTAA |
| Ralstonia eutropha JMP134 | Reut_A3446 | -120 | 3.6 | ATTAGAGCAGGCATTCGAAT |
| Ralstonia eutropha H16 | H16_A3736 | -104 | 4 | CTTCGTACAGCTGTTTCAAG |
| Cupriavidus taiwanensis | RALTA_A3194 | -105 | 4 | CTTCGTACAGCTGTTTCAAG |