Propagation of RutR regulog to Ralstonia eutropha H16
| Source regulog: | RutR - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor (activator) |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/beta |
| Propagated regulon: | |
| Target genome | Ralstonia eutropha H16 |
| Orthologous TF(s) | H16_B1594 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -43
Score: 7.3 Sequence: ACCTGACCATTTGGTCAGGA
Locus tag: H16_B1597
|
||||
| H16_B1597 | -43 | 7.3 | ACCTGACCATTTGGTCAGGA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ribA2 | ||||
| Ortholog function: GTP cyclohydrolase II (EC 3.5.4.25 ) homolog | ||||
| Ralstonia metallidurans CH34 | Rmet_4572 | -45 | 6.9 | ACCTGACCAACTGGTCAGGT |
| Ralstonia eutropha JMP134 | Reut_B3985 | -45 | 7.1 | ACTTGACCATTTGGTCAGGA |
| Ralstonia eutropha H16 | H16_B1597 | -43 | 7.3 | ACCTGACCATTTGGTCAGGA |
| Cupriavidus taiwanensis | RALTA_B1434 | -43 | 7.1 | ACCTGACCGATTGGTCAGGA |