Propagation of PsrA regulog to Burkholderia oklahomensis C6786

Reference regulog properties
Source regulog:	PsrA - Ralstonia
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Phylum:	Proteobacteria/beta
Propagated regulon:
Target genome	Burkholderia oklahomensis C6786
Orthologous TF(s)	BoklC_010100009596
Regulated genes	1

Built upon 9 sites [see more]

Predicted regulatory interactions in *Burkholderia oklahomensis C6786*
	Locus tag	Position	Score	Sequence
Position: -74 Score: 6.3 Sequence: ATGAAAACGGCTGTTTCAAT Locus tag: BoklC_010100009596
	BoklC_010100009596	-74	6.3	ATGAAAACGGCTGTTTCAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: psrA
Ortholog function: Transcriptional regulator for fatty acid degradation PsrA, TetR family
Ralstonia solanacearum GMI1000	RS04928	-122	4.6	TTTAAAACATCCGTTCCTAA
Ralstonia pickettii 12J	Rpic_0418	-121	4.5	TTTCAAACGTCTGTTCCTAA
Ralstonia eutropha JMP134	Reut_A3446	-120	3.6	ATTAGAGCAGGCATTCGAAT
Ralstonia eutropha H16	H16_A3736	-104	4	CTTCGTACAGCTGTTTCAAG
Cupriavidus taiwanensis	RALTA_A3194	-105	4	CTTCGTACAGCTGTTTCAAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --