Propagation of PsrA regulog to Janthinobacterium sp. Marseille
| Source regulog: | PsrA - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/beta |
| Propagated regulon: | |
| Target genome | Janthinobacterium sp. Marseille |
| Orthologous TF(s) | No orthologous TFs found |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -38
Score: 3.6 Sequence: ACACAAATCGTTTTTTTGAT
Locus tag: mma_1357
|
||||
| mma_1357 | -38 | 3.6 | ACACAAATCGTTTTTTTGAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: fabD | ||||
| Ortholog function: Malonyl CoA-acyl carrier protein transacylase (EC 2.3.1.39) | ||||
| Ralstonia metallidurans CH34 | Rmet_2429 | -226 | 2.5 | CATCAAACGCGGGTATGATG |
| Ralstonia eutropha JMP134 | Reut_A2264 | -198 | 2.5 | GATCAAACGCGGGTATGATG |
| Ralstonia eutropha H16 | H16_A2568 | -200 | 2.5 | CATCAAACGCGGGTATGATG |
| Cupriavidus taiwanensis | RALTA_A2071 | -201 | 2.5 | CATCAAACGCGGGTATGATG |