Propagation of Zur regulog to Janthinobacterium sp. Marseille

Reference regulog properties
Source regulog:	Zur - Ralstonia
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/beta
Propagated regulon:
Target genome	Janthinobacterium sp. Marseille
Orthologous TF(s)	mma_3204
Regulated genes	1

Built upon 19 sites [see more]

Predicted regulatory interactions in *Janthinobacterium sp. Marseille*
	Locus tag	Position	Score	Sequence
Position: -148 Score: 6 Sequence: AATTTGCAACCTTGTTGCATTAA Locus tag: mma_0325
	mma_0325	-148	6	AATTTGCAACCTTGTTGCATTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: zip
Ortholog function: Zinc transporter, ZIP family
Ralstonia solanacearum GMI1000	RS01372	-37	5.9	TTCTTGCAACTCTGTTGCGTTTG
Ralstonia pickettii 12J	Rpic_2432	-48	6	TTCTTGCAACTCTGTTGCGTTTA
Ralstonia metallidurans CH34	Rmet_2621	-26	6.4	TTTTTGCAACATTGTTGCGTTAA
Ralstonia eutropha JMP134	Reut_A0876	-3	6.3	TTGTTGCAACATTGTTGCGTTTG
Ralstonia eutropha H16	H16_A2738	-35	6.4	TTATTGCAACATTGTTGCGTTAG
Cupriavidus taiwanensis	RALTA_A2241	-35	6.4	TTATTGCAACATTGTTGCGTTTG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --