Propagation of LexA regulog to Burkholderia pseudomallei 14
| Source regulog: | LexA - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Propagated regulon: | |
| Target genome | Burkholderia pseudomallei 14 |
| Orthologous TF(s) | Bpse14_010100011615 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -108
Score: 5.8 Sequence: CACTGTTTTTTTATACAGTG
Locus tag: Bpse14_010100004618
|
||||
| Bpse14_010100004618 | -108 | 5.8 | CACTGTTTTTTTATACAGTG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: recA | ||||
| Ortholog function: Recombinase A | ||||
| Ralstonia solanacearum GMI1000 | RSc0551 | -180 | 5.5 | CACTGGTTTTTTATACAGTA |
| Ralstonia pickettii 12J | Rpic_0471 | -172 | 5.5 | CACTGGTTTTTTATACAGTA |
| Ralstonia metallidurans CH34 | Rmet_0466 | -171 | 6.1 | TACTGTTTTTTTATACAGTA |
| Ralstonia eutropha JMP134 | Reut_A0527 | -194 | 6.1 | TACTGTTTTTTTATACAGTA |
| Ralstonia eutropha H16 | H16_A0544 | -159 | 6.1 | TACTGTTTTTTTATACAGTA |
| Cupriavidus taiwanensis | RALTA_A0499 | -159 | 6.1 | TACTGTTTTTTTATACAGTA |