Propagation of ModE regulog to Burkholderia pseudomallei 14
Source regulog: | ModE - Ralstonia |
Regulator type: | Transcription factor |
Regulator family: | ModE |
Regulation mode: | repressor |
Biological process: | Molybdenum homeostasis |
Effector: | Molybdate |
Phylum: | Proteobacteria/beta |
Propagated regulon: | |
Target genome | Burkholderia pseudomallei 14 |
Orthologous TF(s) | Bpse14_010100036276 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -108
Score: 4.7 Sequence: TCCGTTATAACCTCGCGTATATTACGAT
Locus tag: Bpse14_010100036256
|
||||
Bpse14_010100036256 | -108 | 4.7 | TCCGTTATAACCTCGCGTATATTACGAT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: modA | ||||
Ortholog function: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) | ||||
Ralstonia solanacearum GMI1000 | RSp0106 | -57 | 4.8 | GGCGTTATATCGGCCCGTATATTACGAT |
Ralstonia pickettii 12J | Rpic_3851 | -58 | 4.4 | ACCGTTATATCGGCTCGTATATTACGCC |
Ralstonia metallidurans CH34 | Rmet_0571 | -63 | 4.8 | TGCGCTATATACCCGCTTATATTGCGCG |
Ralstonia eutropha JMP134 | Reut_A0634 | -82 | 4.8 | CTCGCTATATACAGCCTTATATTGCGCC |
Ralstonia eutropha H16 | H16_A0677 | -89 | 5 | AGCGCTATATACAGACGTATATTGCGCG |
Cupriavidus taiwanensis | RALTA_A0633 | -97 | 4.7 | CGCGCTATATACAGACGTATATTGCGCC |