Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of LexA regulog to Burkholderia pseudomallei 91

Reference regulog properties
Source regulog: LexA - Ralstonia
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Proteobacteria/beta
Propagated regulon:
Target genome Burkholderia pseudomallei 91
Orthologous TF(s) Bpse9_010100012364
Regulated genes 3
Built upon 62 sites [see more]
Predicted regulatory interactions in Burkholderia pseudomallei 91
Locus tag Position Score Sequence
Position: -108
Score: 5.8
Sequence: CACTGTTTTTTTATACAGTG
Locus tag: Bpse9_010100004845
Bpse9_010100004845 -108 5.8 CACTGTTTTTTTATACAGTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: recA
Ortholog function: Recombinase A
Ralstonia solanacearum GMI1000 RSc0551 -180 5.5 CACTGGTTTTTTATACAGTA
Ralstonia pickettii 12J Rpic_0471 -172 5.5 CACTGGTTTTTTATACAGTA
Ralstonia metallidurans CH34 Rmet_0466 -171 6.1 TACTGTTTTTTTATACAGTA
Ralstonia eutropha JMP134 Reut_A0527 -194 6.1 TACTGTTTTTTTATACAGTA
Ralstonia eutropha H16 H16_A0544 -159 6.1 TACTGTTTTTTTATACAGTA
Cupriavidus taiwanensis RALTA_A0499 -159 6.1 TACTGTTTTTTTATACAGTA
Position: -67
Score: 6.4
Sequence: TACTGTATGTTTATACAGTA
Locus tag: Bpse9_010100016977
Bpse9_010100016977 -67 6.4 TACTGTATGTTTATACAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF04055
Ortholog function: DNA repair photolyase
Ralstonia metallidurans CH34 Rmet_0742 -48 6.5 TACTGTATATTTATACAGTA
Ralstonia eutropha H16 H16_A0887 -44 6.5 TACTGTATATATATACAGTG