Propagation of PerR regulog to Bacteroides finegoldii DSM 17565

Reference regulog properties
Source regulog:	PerR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Phylum:	Bacteroidetes
Propagated regulon:
Target genome	Bacteroides finegoldii DSM 17565
Orthologous TF(s)	BACFIN_00790
Regulated genes	2

Built upon 51 sites [see more]

Predicted regulatory interactions in *Bacteroides finegoldii DSM 17565*
	Locus tag	Position	Score	Sequence
Position: -35 Score: 6.2 Sequence: ATATTTGTACTCATTACAAATTC Locus tag: BACFIN_01834
	BACFIN_01834	-35	6.2	ATATTTGTACTCATTACAAATTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: BT1211
Ortholog function: hypothetical protein
Bacteroides cellulosilyticus DSM 14838	BACCELL_04244	-29	6.5	ATATTTGTAATGATTATAAATTT
Bacteroides dorei DSM 17855	BACDOR_04415	-34	5.9	TTCTTTGTAATTATTACAACTTT
Bacteroides eggerthii DSM 20697	BACEGG_02389	-30	6.2	ATATTTGTAATGATTATAATTTG
Bacteroides ovatus ATCC 8483	BACOVA_03967	-35	6.2	ATATTTGTACTCATTACAAATTA
Bacteroides plebeius DSM 17135	BACPLE_02813	-28	5.5	TACTTTGTAATCATTATAAAAAT
Bacteroides stercoris ATCC 43183	BACSTE_00833	-29	6.2	ATATTTGTAATGATTATAATTTG
Bacteroides thetaiotaomicron VPI-5482	BT1211	-35	6.2	ATATTTGTACTCATTACAAATTC
Bacteroides uniformis ATCC 8492	BACUNI_02171	70	6.5	ATATTTGTAATCATTATAATTTT
Bacteroides coprophilus DSM 18228	BACCOPRO_00522	-28	5.2	TCCTTTGTAATTATTATAAAAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --