Propagation of ManR regulog to Bacteroides finegoldii DSM 17565

Reference regulog properties
Source regulog:	ManR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Phylum:	Bacteroidetes
Propagated regulon:
Target genome	Bacteroides finegoldii DSM 17565
Orthologous TF(s)	BACFIN_03384
Regulated genes	2

Built upon 9 sites [see more]

Predicted regulatory interactions in *Bacteroides finegoldii DSM 17565*
	Locus tag	Position	Score	Sequence
Position: -41 Score: 5.9 Sequence: AAGTATGTATGAACATATAA Locus tag: BACFIN_03383
	BACFIN_03383	-41	5.9	AAGTATGTATGAACATATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: pmi
Ortholog function: Mannose-6-phosphate isomerase (EC 5.3.1.8)
Bacteroides eggerthii DSM 20697	BACEGG_01985	-29	5.4	ATATATGTTCAAACAAAGTA
Bacteroides ovatus ATCC 8483	BACOVA_03250	-4	5.9	AAGTATGTATGAACATATAA
Bacteroides thetaiotaomicron VPI-5482	BT2104	-41	5.8	TTATATGTTCAGACATACTA

Position: -26 Score: 5.9 Sequence: TTATATGTTCATACATACTT Locus tag: BACFIN_03384
	BACFIN_03384	-26	5.9	TTATATGTTCATACATACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: manR
Ortholog function: Predicted transcriptional regulator of Mannose utilization, GntR family
Bacteroides eggerthii DSM 20697	BACEGG_01984	-119	5.4	TACTTTGTTTGAACATATAT
Bacteroides ovatus ATCC 8483	BACOVA_03251	22	5.9	TTATATGTTCATACATACTT
Bacteroides thetaiotaomicron VPI-5482	BT2103	-108	5.8	TAGTATGTCTGAACATATAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --