Propagation of NrfR regulog to Bacteroides thetaiotaomicron VPI-5482

Reference regulog properties
Source regulog:	NrfR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrate and nitrite respiration
Effector:	Nitrite
Phylum:	Bacteroidetes
Propagated regulon:
Target genome	Bacteroides thetaiotaomicron VPI-5482
Orthologous TF(s)	BT1413
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Bacteroides thetaiotaomicron VPI-5482*
	Locus tag	Position	Score	Sequence
Position: -66 Score: 6.6 Sequence: GGTGTAATAGTTATTACACC Locus tag: BT1418
	BT1418	-66	6.6	GGTGTAATAGTTATTACACC
Supported by regulated orthologs from reference regulons
Ortholog gene name: nrfH
Ortholog function: Cytochrome c nitrite reductase, small subunit NrfH
Bacteroides cellulosilyticus DSM 14838	BACCELL_02840	-65	6.6	GATGTAATCATTATTACACT
Bacteroides fragilis NCTC 9343	BF0360	-73	6.1	AATGTAATCTGGATTACATC
Bacteroides ovatus ATCC 8483	BACOVA_00831	-65	6.4	GGTGTAATAGATATTACACC
Bacteroides plebeius DSM 17135	BACPLE_01440	27	6	GGTGTCATATTTATTACACC
Bacteroides thetaiotaomicron VPI-5482	BT1418	-66	6.6	GGTGTAATAGTTATTACACC
Bacteroides uniformis ATCC 8492	BACUNI_04432	-64	6.5	AATGTAATCATGATTACACT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --