Propagation of UxaR regulog to Bacteroides thetaiotaomicron VPI-5482

Reference regulog properties
Source regulog:	UxaR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Glucuronate utilization; Galacturonate utilization
Effector:	Glucuronate; Galacturonate
Phylum:	Bacteroidetes
Propagated regulon:
Target genome	Bacteroides thetaiotaomicron VPI-5482
Orthologous TF(s)	BT0824
Regulated genes	2

Built upon 12 sites [see more]

Predicted regulatory interactions in *Bacteroides thetaiotaomicron VPI-5482*
	Locus tag	Position	Score	Sequence
Position: -166 Score: 6.1 Sequence: GCAAATATACGAATTATTTT Locus tag: BT_0823
	BT_0823	-166	6.1	GCAAATATACGAATTATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: uxaC
Ortholog function: Uronate isomerase (EC 5.3.1.12)
Bacteroides cellulosilyticus DSM 14838	BACCELL_04798	-166	6.1	GCAAAGATACGAATTATTTT
Bacteroides eggerthii DSM 20697	BACEGG_02664	-166	6	GCAAAGATACGAATAATTTT
Bacteroides ovatus ATCC 8483	BACOVA_02558	-165	6.1	GCAAATATACGAATTATTTT
Bacteroides stercoris ATCC 43183	BACSTE_01410	-166	6.1	GCAAAGATACGAATTATTTT
Bacteroides thetaiotaomicron VPI-5482	BT_0823	-166	6.1	GCAAATATACGAATTATTTT
Bacteroides uniformis ATCC 8492	BACUNI_00659	-166	6.1	GCAAAGATACGAATTATTTT

Position: -92 Score: 6.1 Sequence: AAAATAATTCGTATATTTGC Locus tag: BT0824
	BT0824	-92	6.1	AAAATAATTCGTATATTTGC
Supported by regulated orthologs from reference regulons
Ortholog gene name: uxaR
Ortholog function: Predicted transcriptional regulator for galacturonate catabolism, LacI family
Bacteroides cellulosilyticus DSM 14838	BACCELL_04799	-91	6.1	AAAATAATTCGTATCTTTGC
Bacteroides eggerthii DSM 20697	BACEGG_02665	-85	6	AAAATTATTCGTATCTTTGC
Bacteroides ovatus ATCC 8483	BACOVA_02559	-53	6.1	AAAATAATTCGTATATTTGC
Bacteroides stercoris ATCC 43183	BACSTE_01411	-84	6.1	AAAATAATTCGTATCTTTGC
Bacteroides thetaiotaomicron VPI-5482	BT0824	-92	6.1	AAAATAATTCGTATATTTGC
Bacteroides uniformis ATCC 8492	BACUNI_00658	-87	6.1	AAAATAATTCGTATCTTTGC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --