Propagation of MsmR regulog to Bacillus pumilus SAFR-032

Reference regulog properties
Source regulog:	MsmR - Bacillales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-galactosides utilization
Effector:	Alpha-galactosides
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus pumilus SAFR-032
Orthologous TF(s)	BPUM_1754
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Bacillus pumilus SAFR-032*
	Locus tag	Position	Score	Sequence
Position: -80 Score: 4.4 Sequence: ACTTGAAAGCGCTTTACCAA Locus tag: BPUM_1754
	BPUM_1754	-80	4.4	ACTTGAAAGCGCTTTACCAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: msmR
Ortholog function: Transcriptional regulator of alpha-galactoside utilization, LacI family
Bacillus subtilis subsp. subtilis str. 168	BSU30260	-88	5.5	TATTGTAACCGCTTACTTTT
Bacillus amyloliquefaciens FZB42	RBAM_027180	-93	5.4	TGTTGAAAACGCTTACTCTC
Bacillus pumilus SAFR-032	BPUM_1754	-80	4.4	ACTTGAAAGCGCTTTACCAA
Bacillus licheniformis DSM 13	BLi01139	-77	4.6	TATTGAAAACTTTTACCTTG
Bacillus halodurans C-125	BH2227	-97	5.8	TATTGAAAACGCTTACCCTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --