Propagation of CzrA regulog to Bacillus pumilus SAFR-032

Reference regulog properties
Source regulog:	CzrA - Bacillales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector:	Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus pumilus SAFR-032
Orthologous TF(s)	BPUM_1843
Regulated genes	1

Built upon 16 sites [see more]

Predicted regulatory interactions in *Bacillus pumilus SAFR-032*
	Locus tag	Position	Score	Sequence
Position: -87 Score: 7.3 Sequence: TATATGAATATATGCTCATATA Locus tag: BPUM_3010
	BPUM_3010	-87	7.3	TATATGAATATATGCTCATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: cadA
Ortholog function: Cadmium-transporting ATPase (EC 3.6.3.3)
Bacillus subtilis subsp. subtilis str. 168	BSU33490	-94	7.3	TATATGAGTATATGCTCATATA
Bacillus amyloliquefaciens FZB42	RBAM_030670	-87	7.3	TATATGAGTATATGTTCATATA
Bacillus pumilus SAFR-032	BPUM_3010	-87	7.3	TATATGAATATATGCTCATATA
Bacillus licheniformis DSM 13	BLi03539	-61	6.9	TATATGCGTATATGCTCATATA
Bacillus cereus ATCC 14579	BC0596	-46	5.7	TATATGAatgatTGtTCATATg

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --