Propagation of PerR regulog to Bacteroides ovatus ATCC 8483

Reference regulog properties
Source regulog:	PerR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Phylum:	Bacteroidetes
Propagated regulon:
Target genome	Bacteroides ovatus ATCC 8483
Orthologous TF(s)	BACOVA_00376
Regulated genes	4

Built upon 51 sites [see more]

Predicted regulatory interactions in *Bacteroides ovatus ATCC 8483*
	Locus tag	Position	Score	Sequence
Position: -40 Score: 6.3 Sequence: ATAATTGTAATGAATACAACTTT Locus tag: BACOVA_00376
	BACOVA_00376	-40	6.3	ATAATTGTAATGAATACAACTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: perR
Ortholog function: Peroxide stress regulator PerR, Fur family
Bacteroides ovatus ATCC 8483	BACOVA_00376	-40	6.3	ATAATTGTAATGAATACAACTTT
Bacteroides thetaiotaomicron VPI-5482	BT0215	-40	6.3	ATAATTGTAATGAATACAACTTT

Position: -33 Score: 5.6 Sequence: ATATTTGTAATAATTGTATTTAT Locus tag: BACOVA_02789
	BACOVA_02789	-33	5.6	ATATTTGTAATAATTGTATTTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF01637
Ortholog function: Archaeal ATPase family protein
Bacteroides fragilis NCTC 9343	BF3647	-36	5.9	ATATTTGCAATAATTATAAATAT
Bacteroides ovatus ATCC 8483	BACOVA_02789	-33	5.6	ATATTTGTAATAATTGTATTTAT

Position: -35 Score: 6.2 Sequence: ATATTTGTACTCATTACAAATTA Locus tag: BACOVA_03967
	BACOVA_03967	-35	6.2	ATATTTGTACTCATTACAAATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: BT1211
Ortholog function: hypothetical protein
Bacteroides cellulosilyticus DSM 14838	BACCELL_04244	-29	6.5	ATATTTGTAATGATTATAAATTT
Bacteroides dorei DSM 17855	BACDOR_04415	-34	5.9	TTCTTTGTAATTATTACAACTTT
Bacteroides eggerthii DSM 20697	BACEGG_02389	-30	6.2	ATATTTGTAATGATTATAATTTG
Bacteroides ovatus ATCC 8483	BACOVA_03967	-35	6.2	ATATTTGTACTCATTACAAATTA
Bacteroides plebeius DSM 17135	BACPLE_02813	-28	5.5	TACTTTGTAATCATTATAAAAAT
Bacteroides stercoris ATCC 43183	BACSTE_00833	-29	6.2	ATATTTGTAATGATTATAATTTG
Bacteroides thetaiotaomicron VPI-5482	BT1211	-35	6.2	ATATTTGTACTCATTACAAATTC
Bacteroides uniformis ATCC 8492	BACUNI_02171	70	6.5	ATATTTGTAATCATTATAATTTT
Bacteroides coprophilus DSM 18228	BACCOPRO_00522	-28	5.2	TCCTTTGTAATTATTATAAAAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of PerR regulog to Bacteroides ovatus ATCC 8483

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --