Propagation of NrfR regulog to Bacteroides cellulosilyticus DSM 14838
| Source regulog: | NrfR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | Nitrate and nitrite respiration |
| Effector: | Nitrite |
| Phylum: | Bacteroidetes |
| Propagated regulon: | |
| Target genome | Bacteroides cellulosilyticus DSM 14838 |
| Orthologous TF(s) | BACCELL_02845 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -65
Score: 6.6 Sequence: GATGTAATCATTATTACACT
Locus tag: BACCELL_02840
|
||||
| BACCELL_02840 | -65 | 6.6 | GATGTAATCATTATTACACT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: nrfH | ||||
| Ortholog function: Cytochrome c nitrite reductase, small subunit NrfH | ||||
| Bacteroides cellulosilyticus DSM 14838 | BACCELL_02840 | -65 | 6.6 | GATGTAATCATTATTACACT |
| Bacteroides fragilis NCTC 9343 | BF0360 | -73 | 6.1 | AATGTAATCTGGATTACATC |
| Bacteroides ovatus ATCC 8483 | BACOVA_00831 | -65 | 6.4 | GGTGTAATAGATATTACACC |
| Bacteroides plebeius DSM 17135 | BACPLE_01440 | 27 | 6 | GGTGTCATATTTATTACACC |
| Bacteroides thetaiotaomicron VPI-5482 | BT1418 | -66 | 6.6 | GGTGTAATAGTTATTACACC |
| Bacteroides uniformis ATCC 8492 | BACUNI_04432 | -64 | 6.5 | AATGTAATCATGATTACACT |