Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NrfR regulog to Bacteroides cellulosilyticus DSM 14838

Reference regulog properties
Source regulog: NrfR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process: Nitrate and nitrite respiration
Effector: Nitrite
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides cellulosilyticus DSM 14838
Orthologous TF(s) BACCELL_02845
Regulated genes 1
Built upon 6 sites [see more]
Predicted regulatory interactions in Bacteroides cellulosilyticus DSM 14838
Locus tag Position Score Sequence
Position: -65
Score: 6.6
Sequence: GATGTAATCATTATTACACT
Locus tag: BACCELL_02840
BACCELL_02840 -65 6.6 GATGTAATCATTATTACACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nrfH
Ortholog function: Cytochrome c nitrite reductase, small subunit NrfH
Bacteroides cellulosilyticus DSM 14838 BACCELL_02840 -65 6.6 GATGTAATCATTATTACACT
Bacteroides fragilis NCTC 9343 BF0360 -73 6.1 AATGTAATCTGGATTACATC
Bacteroides ovatus ATCC 8483 BACOVA_00831 -65 6.4 GGTGTAATAGATATTACACC
Bacteroides plebeius DSM 17135 BACPLE_01440 27 6 GGTGTCATATTTATTACACC
Bacteroides thetaiotaomicron VPI-5482 BT1418 -66 6.6 GGTGTAATAGTTATTACACC
Bacteroides uniformis ATCC 8492 BACUNI_04432 -64 6.5 AATGTAATCATGATTACACT