Propagation of LicR regulog to Bacillus pumilus SAFR-032

Reference regulog properties
Source regulog:	LicR - Bacillales
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	activator
Biological process:	Beta-glucosides utilization
Effector:	HPr, phosphocarrier protein; LicB, lichenan-specific enzyme IIB PTS component
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus pumilus SAFR-032
Orthologous TF(s)	BPUM_0214, BPUM_3541, BPUM_3507
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Bacillus pumilus SAFR-032*
	Locus tag	Position	Score	Sequence
Position: -105 Score: 5.7 Sequence: TTTCCGCTTCCTAAAGGAAAA Locus tag: BPUM_3506
	BPUM_3506	-105	5.7	TTTCCGCTTCCTAAAGGAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: licB
Ortholog function: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Bacillus subtilis subsp. subtilis str. 168	BSU38590	-111	5.5	TTTTCCGTTGCCTGCGGAAAA
Bacillus amyloliquefaciens FZB42	RBAM_035790	-109	6.2	TTTTCCGTTAACAGCGGAAAA
Bacillus pumilus SAFR-032	BPUM_3506	-105	5.7	TTTCCGCTTCCTAAAGGAAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --