Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NiaR regulog to Bacillus pumilus SAFR-032

Reference regulog properties
Source regulog: NiaR - Bacillales
Regulator type: Transcription factor
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus pumilus SAFR-032
Orthologous TF(s) BPUM_2429
Regulated genes 1
Built upon 26 sites [see more]
Predicted regulatory interactions in Bacillus pumilus SAFR-032
Locus tag Position Score Sequence
Position: -38
Score: 5.9
Sequence: GATATGTGTCAAGACAGGTGTA
Locus tag: BPUM_2427
BPUM_2427 -38 5.9 GATATGTGTCAAGACAGGTGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nadB
Ortholog function: L-aspartate oxidase (EC 1.4.3.16)
Bacillus subtilis subsp. subtilis str. 168 BSU27870 -41 6.5 TATAGGTGTCAAGACAGGTGTA
Bacillus amyloliquefaciens FZB42 RBAM_024920 -43 6.5 TATAGGTGTCAAGACAGGTGTA
Bacillus pumilus SAFR-032 BPUM_2427 -38 5.9 GATATGTGTCAAGACAGGTGTA
Bacillus licheniformis DSM 13 BLi02914 -42 6.6 TATAGGTGTCAAGACACATGTA
© 2009-2020 RegPrecise