Propagation of Cg1831 regulog to Corynebacterium glutamicum R

Reference regulog properties
Source regulog:	Cg1831 - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:
Phylum:	Actinobacteria
Propagated regulon:
Target genome	Corynebacterium glutamicum R
Orthologous TF(s)	cgR_1673
Regulated genes	2

Built upon 4 sites [see more]

Predicted regulatory interactions in *Corynebacterium glutamicum R*
	Locus tag	Position	Score	Sequence
Position: -40 Score: 6.5 Sequence: ACTCAAATGATCATTTGACT Locus tag: cgR_1673
	cgR_1673	-40	6.5	ACTCAAATGATCATTTGACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cg1831
Ortholog function: Predicted Fe-siderophore transport transcriptional regulator, MerR family
Corynebacterium efficiens YS-314	CE2678	8	5.9	ACTCAATCACCCGTTTGACT
Corynebacterium glutamicum ATCC 13032	cg1831	-40	6.5	ACTCAAATGATCATTTGACT

Position: -34 Score: 6.5 Sequence: AGTCAAATGATCATTTGAGT Locus tag: cgR_1674
	cgR_1674	-34	6.5	AGTCAAATGATCATTTGAGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cg1832
Ortholog function: Predicted Fe-siderophore ABC transporter, permease protein
Corynebacterium efficiens YS-314	CE2677	-34	5.9	AGTCAAACGGGTGATTGAGT
Corynebacterium glutamicum ATCC 13032	cg1832	-34	6.5	AGTCAAATGATCATTTGAGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --