Propagation of PcaO regulog to Corynebacterium glutamicum R

Reference regulog properties
Source regulog:	PcaO - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	LuxR
Regulation mode:	activator
Biological process:	Protocatechuate degradation
Effector:	Protocatechuate
Phylum:	Actinobacteria
Propagated regulon:
Target genome	Corynebacterium glutamicum R
Orthologous TF(s)	cgR_2276, cgR_2289
Regulated genes	1

Built upon 2 sites [see more]

Predicted regulatory interactions in *Corynebacterium glutamicum R*
	Locus tag	Position	Score	Sequence
Position: -137 Score: 6.4 Sequence: AACCCCTGACCTTCGGGGTT Locus tag: cgR_2280
	cgR_2280	-137	6.4	AACCCCTGACCTTCGGGGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: pcaH
Ortholog function: Protocatechuate 3,4-dioxygenase beta chain (EC 1.13.11.3)
Corynebacterium efficiens YS-314	CE2301	-127	6.4	ACCCCCAAAGCTGCTGGTGG
Corynebacterium glutamicum ATCC 13032	cg2631	-137	6.4	AACCCCTGACCTTCGGGGTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --