Propagation of Cg1831 regulog to Corynebacterium efficiens YS-314

Reference regulog properties
Source regulog:	Cg1831 - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:
Phylum:	Actinobacteria
Propagated regulon:
Target genome	Corynebacterium efficiens YS-314
Orthologous TF(s)	CE2678
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Corynebacterium efficiens YS-314*
	Locus tag	Position	Score	Sequence
Position: 8 Score: 5.9 Sequence: ACTCAATCACCCGTTTGACT Locus tag: CE2678
	CE2678	8	5.9	ACTCAATCACCCGTTTGACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cg1831
Ortholog function: Predicted Fe-siderophore transport transcriptional regulator, MerR family
Corynebacterium efficiens YS-314	CE2678	8	5.9	ACTCAATCACCCGTTTGACT
Corynebacterium glutamicum ATCC 13032	cg1831	-40	6.5	ACTCAAATGATCATTTGACT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --