Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PcaO regulog to Corynebacterium efficiens YS-314

Reference regulog properties
Source regulog: PcaO - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: LuxR
Regulation mode: activator
Biological process: Protocatechuate degradation
Effector: Protocatechuate
Phylum: Actinobacteria
Propagated regulon:
Target genome Corynebacterium efficiens YS-314
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 2 sites [see more]
Predicted regulatory interactions in Corynebacterium efficiens YS-314
Locus tag Position Score Sequence
Position: -127
Score: 6.4
Sequence: ACCCCCAAAGCTGCTGGTGG
Locus tag: CE2301
CE2301 -127 6.4 ACCCCCAAAGCTGCTGGTGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: pcaH
Ortholog function: Protocatechuate 3,4-dioxygenase beta chain (EC 1.13.11.3)
Corynebacterium efficiens YS-314 CE2301 -127 6.4 ACCCCCAAAGCTGCTGGTGG
Corynebacterium glutamicum ATCC 13032 cg2631 -137 6.4 AACCCCTGACCTTCGGGGTT
© 2009-2020 RegPrecise