Propagation of SufR regulog to Corynebacterium kroppenstedtii DSM 44385
Source regulog: | SufR - Corynebacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | ArsR |
Regulation mode: | repressor |
Biological process: | Iron-sulfur cluster biogenesis |
Effector: | Iron-sulfur cluster redox state |
Phylum: | Actinobacteria |
Propagated regulon: | |
Target genome | Corynebacterium kroppenstedtii DSM 44385 |
Orthologous TF(s) | ckrop_0953 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -223
Score: 6.1 Sequence: TTCCGACACACTAATGTTGTGTAA
Locus tag: ckrop_0953
|
||||
ckrop_0953 | -223 | 6.1 | TTCCGACACACTAATGTTGTGTAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: sufR | ||||
Ortholog function: Iron-sulfur cluster biogenesis transcriptional regulator SufR, ArsR family | ||||
Corynebacterium amycolatum SK46 | CORAM0001_0944 | -119 | 7 | TTACGACACAATTATGTTGTCTAA |
Corynebacterium aurimucosum ATCC 700975 | cauri_1215 | -57 | 7.3 | TTAAGGAACACTAGTGTTGTCTAA |
Corynebacterium diphtheriae NCTC 13129 | DIP1296 | -163 | 5.3 | CTAACCTGCACTTTTGTGGGTTAT |
Corynebacterium efficiens YS-314 | CE1687 | -72 | 7.5 | TTAGGGAACACTTGTGTTGTCTAA |
Corynebacterium glutamicum ATCC 13032 | cg1765 | -58 | 7.5 | TTAGGGAACACTTGTGTTGTCTAA |
Corynebacterium jeikeium K411 | jk0985 | -88 | 7.5 | TTACGACACACTTTTGTTGTCTAA |
Corynebacterium kroppenstedtii DSM 44385 | ckrop_0953 | -223 | 6.1 | TTCCGACACACTAATGTTGTGTAA |
Corynebacterium urealyticum DSM 7109 | cur_1006 | -59 | 7.3 | TTAAGACACACTCTTGTTGTCTAA |