Propagation of MntR regulog to Corynebacterium aurimucosum ATCC 700975

Reference regulog properties
Source regulog:	MntR - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Actinobacteria
Propagated regulon:
Target genome	Corynebacterium aurimucosum ATCC 700975
Orthologous TF(s)	cauri_0335
Regulated genes	2

Built upon 16 sites [see more]

Predicted regulatory interactions in *Corynebacterium aurimucosum ATCC 700975*
	Locus tag	Position	Score	Sequence
Position: -51 Score: 6.7 Sequence: AAGTTCAATCCATTGAACAT Locus tag: cauri_0334
	cauri_0334	-51	6.7	AAGTTCAATCCATTGAACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntM
Ortholog function: Manganese ABC transporter, substrate-binding protein
Corynebacterium aurimucosum ATCC 700975	cauri_0334	-51	6.7	AAGTTCAATCCATTGAACAT

Position: -76 Score: 6.5 Sequence: ATGTTCAATGGATTGAACTT Locus tag: cauri_0335
	cauri_0335	-76	6.5	ATGTTCAATGGATTGAACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntR
Ortholog function: Mn-dependent transcriptional regulator MntR, DtxR family
Corynebacterium amycolatum SK46	CORAM0001_0538	-153	6.1	AAGTTCAATGGGTTGAAAAT
Corynebacterium aurimucosum ATCC 700975	cauri_0335	-76	6.5	ATGTTCAATGGATTGAACTT
Corynebacterium diphtheriae NCTC 13129	DIP0619	-91	5.6	AAATTCAATACGCTGAACAG
Corynebacterium jeikeium K411	jk1485	-86	6.2	ATGTTCAATGTATTGAACAA
Corynebacterium kroppenstedtii DSM 44385	ckrop_1571	-143	5.7	AAGTTCAATGCAATGTATTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --