Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mntM gene

Properties
Regulog: MntR - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Actinobacteria
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium aurimucosum ATCC 700975
Position: -51
Score: 6.66413
Sequence: AAGTTCAATCCATTGAACAT
Locus tag: cauri_0334
Name: mntM
Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: cauri_0333
Name: mntN
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: cauri_0332
Name: mntO
Funciton: Manganese ABC transporter, permease protein 2
Locus tag: cauri_0331
Name: mntQ
Funciton: Manganese ABC transporter, permease protein 2
mntM-mntN-mntO-mntQ -51 6.7 AAGTTCAATCCATTGAACAT cauri_0334
© 2009-2020 RegPrecise