Propagation of PadR regulog to Bacillus pumilus SAFR-032

Reference regulog properties
Source regulog:	PadR - Bacillales
Regulator type:	Transcription factor
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Phenolic acid stress response
Effector:	p-Coumaric acid; Ferulic acid
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus pumilus SAFR-032
Orthologous TF(s)	BPUM_0713
Regulated genes	2

Built upon 5 sites [see more]

Predicted regulatory interactions in *Bacillus pumilus SAFR-032*
	Locus tag	Position	Score	Sequence
Position: -59 Score: 6.9 Sequence: AAACATGTAAATCACGACATGTTT Locus tag: BPUM_0712
	BPUM_0712	-59	6.9	AAACATGTAAATCACGACATGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: padC
Ortholog function: Phenolic acid decarboxylase (EC 4.1.1.-)
Bacillus amyloliquefaciens FZB42	RBAM_031730	-95	7.1	AAACGTGTAAATAGTTACATGTTT
Bacillus licheniformis DSM 13	BLi03407	-58	6.6	ATATATGTAAATATCAACATGTTT
Bacillus pumilus SAFR-032	BPUM_0712	-59	6.9	AAACATGTAAATCACGACATGTTT
Bacillus subtilis subsp. subtilis str. 168	BSU34400	-48	6.8	GAACATGTAAATAGTTACATGATT

Position: -77 Score: 6.9 Sequence: AAACATGTCGTGATTTACATGTTT Locus tag: BPUM_0713
	BPUM_0713	-77	6.9	AAACATGTCGTGATTTACATGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: padR
Ortholog function: Transcriptional regulator of phenolic acid stress response, PadR family
Bacillus pumilus SAFR-032	BPUM_0713	-77	6.9	AAACATGTCGTGATTTACATGTTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --