Propagation of Dbac_0104 regulog to Desulfovibrio magneticus RS-1

Reference regulog properties
Source regulog:	Dbac_0104 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:
Biological process:	Metabolite transport
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio magneticus RS-1
Orthologous TF(s)	DMR_28390
Regulated genes	1

Built upon 6 sites [see more]

Predicted regulatory interactions in *Desulfovibrio magneticus RS-1*
	Locus tag	Position	Score	Sequence
Position: -26 Score: 5.3 Sequence: TTGTGAACCGGTGTTAACTT Locus tag: DMR_28390
	DMR_28390	-26	5.3	TTGTGAACCGGTGTTAACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: DMR_28390
Ortholog function: TetR family transcriptional regulator
Desulfovibrio magneticus RS-1	DMR_28390	-26	5.3	TTGTGAACCGGTGTTAACTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --