Propagation of ArsR2 regulog to Desulfovibrio magneticus RS-1

Reference regulog properties
Source regulog:	ArsR2 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio magneticus RS-1
Orthologous TF(s)	DMR_37370
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Desulfovibrio magneticus RS-1*
	Locus tag	Position	Score	Sequence
Position: -226 Score: 5 Sequence: ATTTTGGTAGTTTGAAAAAT Locus tag: DMR_01880
	DMR_01880	-226	5	ATTTTGGTAGTTTGAAAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: arsC-1
Ortholog function: Arsenate reductase (EC 1.20.4.1)
Desulfovibrio desulfuricans G20	Dde_2792	-143	5.6	ATTTTGATGACACTCAAAAT
Desulfovibrio magneticus RS-1	DMR_01880	-226	5	ATTTTGGTAGTTTGAAAAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --