Propagation of Desal_3745 regulog to Desulfovibrio salexigens DSM 2638

Reference regulog properties
Source regulog:	Desal_3745 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Metabolite transport
Effector:
Phylum:	Proteobacteria/delta
Propagated regulon:
Target genome	Desulfovibrio salexigens DSM 2638
Orthologous TF(s)	Desal_3745
Regulated genes	2

Built upon 2 sites [see more]

Predicted regulatory interactions in *Desulfovibrio salexigens DSM 2638*
	Locus tag	Position	Score	Sequence
Position: -37 Score: 6.3 Sequence: CTTGACATTGTATGCAGTCAAA Locus tag: Desal_3745
	Desal_3745	-37	6.3	CTTGACATTGTATGCAGTCAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: Desal_3745
Ortholog function: Transcriptional regulator, GntR family
Desulfovibrio salexigens DSM 2638	Desal_3745	-37	6.3	CTTGACATTGTATGCAGTCAAA

Position: -235 Score: 6.3 Sequence: TTTGACTGCATACAATGTCAAG Locus tag: Desal_3746
	Desal_3746	-235	6.3	TTTGACTGCATACAATGTCAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: Desal_3746
Ortholog function: Lysine exporter protein (LYSE/YGGA)
Desulfovibrio salexigens DSM 2638	Desal_3746	-235	6.3	TTTGACTGCATACAATGTCAAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --